In the meantime, to ensure continued support, we are displaying the site without styles and JavaScript.We obtained breast cancer cell lines, including MDA-MB-468, T47D and MCF7 from ATCC (American Type Culture Collection, Manassas, VA). Lo and Q. Zhou.
The tumorsphere formation efficiency (TFE assay) indicates the percentage of cells within a cancer cell culture that are capable of forming a sphere from a single cell. 431386)3.5.
Store at −20°C for later use.5.8. H.Y.
no. However, AZA treatment did not activate expression of snail or CD44 (data not shown).Bisulfite sequencing PCR was evaluated using bisulfite-modified DNA at CD87 promoter region with the following primers: forward, TTTGGGGATAGAGTTGTGATT; reverse, CCTCAATTAAACCCTATTCCAA.
Place the dissected parts of the UGS in a 100-mm Petri dish with Dulbecco's Modified Eagle's Medium (DMEM) Harvest media.6.2. Expression levels of slug and CD87 were then quantified using GoTaq® qPCR Master Mix (Promega, Madison, WI, USA) and primers specific for slug and CD87 on an Exicycler™ 96 (Bioneer, Daejeon, Korea). The present study confirmed that slug and CD87 were activated by TGF-β, which were related with their aberrant promoter demethylation.A human normal lung epithelial cell line and four lung cancer cell lines were purchased from the American Type Culture Collection (ATCC, Manassas, VA, USA). Aspirate the D-PBS. no. 251275)8.2. C.Y. 10813012)7.2. Lo. Sacrifice the male mouse (8-12 weeks old) using isoflurane inhalation followed by cervical dislocation.4.4. 354230)3.3. M7145)PrEGM media (see Reagent Setup)Normal Goat Serum (NGS; Invitrogen, cat. This basic protocol for culture and assay can be adapted for all spheroid microplates. H6520)1.1. Our device offers a new approach for single-cell-derived sphere formation according to tumor cell different biomechanical properties. Tumor-spheres derived from different biomechanics (size and/or deformation) single-cells could be formed efficiently using this device. Cells were maintained at 37 ℃ in a 5% CO2 humidified atmosphere.
no. This work was also supported by the NIH/NCI (R01CA157779).
TFE values are a quantitative measurement to measure the amount of cancer stem cells within a tumor/cancer cell line and is correlated with cancer metastasis and aggressiveness. no. All authors read and approved the manuscript.Representative demonstration of CpG site methylation changes of CD87 promoter region in BEAS-2B and A549 cells. In vitro propagation and transcriptional profiling of human mammary stem / progenitor cells. Aspirate the medium from the center of the well and add to each well 500 μL of dispase solution dissolved in the spheres' appropriate growth media (at a final concentration of 1 mg/mL).
Z359629)Confocal microscope (Zeiss LSM 710)3.1. 8, (5), 486-498 (2011). 48723)Tissue culture plate (12 well; Corning, cat. Dissolve the RNA pellet in 100 μL diethyl pyrocarbonate (DEPC)-treated water.Isoflurane (Abbott, cat. Proteins (20 μg) extracted from cells were separated on SDS-PAGE gel and transferred to a nitrocellulose membrane. S.K. Mince the tissue with a sterile scalpel blade into very small pieces of around 0.3–0.5 mm in size and then transfer the minced tissue into a 15 mL conical tube.
T.K..: Supervision and review. Sphere formation assay. no. Bisulfite-modified DNA was amplified using GoTaq® Green Master Mix (Promega, Madison, WI, USA), 10 μM of each primer, and 250 ng of template DNA using MyCycler™ PCR machine (Bio-Rad, Hercules, CA, USA).
: Performing experiments, writing, methodology and review. Start the mechanical dissociation by passing the mixture gently through a series of needles with different gauges.
Transfer into a 15 mL conical tube and spin down the cells at 200 x g for 5 min.